Mature sequence gga-miR-1805-3p

Accession numberMIMAT0007723
IDgga-miR-1805-3p
Stem-Loop gga-mir-1805
Sequence
uguauuggaacacuacagcuc
Get sequence
Deep sequencing8735 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).