Mature sequence gga-miR-449b-3p

Accession numberMIMAT0007744
IDgga-miR-449b-3p
Previous IDsgga-miR-449b*
Stem-Loop gga-mir-449b
Sequence
cagucacuaccacacugccac
Get sequence
Deep sequencing3 reads, 1 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).