Mature sequence gga-miR-458a-5p

• Accession number: MIMAT0007745
• ID: gga-miR-458a-5p
• Previous IDs: gga-miR-458*
• Stem-Loop: gga-mir-458a
• Sequence: agcgccauuuucagagcuaua
• Deep sequencing: 12 reads, 2 experiments
• Predicted targets:
  • TargetScanVert:gga-miR-458a-5p
  • miRDB:gga-miR-458a-5p

References

1. PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2. PMID:18511220 "Identification of novel chicken microRNAs and analysis of their genomic organization" Shao P, Zhou H, Xiao ZD, He JH, Huang MB, Chen YQ, Qu LH Gene. 418:34-40(2008).