Mature sequence mmu-miR-1903

Accession numberMIMAT0007868
IDmmu-miR-1903
Stem-Loop mmu-mir-1903
Sequence
ccuucuucuucuuccugagaca
Get sequence
Deep sequencing25 reads, 16 experiments
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).