Mature sequence hsa-miR-1909-3p

Accession numberMIMAT0007883
IDhsa-miR-1909-3p
Previous IDshsa-miR-1909
Stem-Loop hsa-mir-1909
Sequence
cgcaggggccgggugcucaccg
Get sequence
Deep sequencing41 reads, 28 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).