Mature sequence hsa-miR-1915-5p

Accession numberMIMAT0007891
IDhsa-miR-1915-5p
Previous IDshsa-miR-1915*
Stem-Loop hsa-mir-1915
Sequence
accuugccuugcugcccgggcc
Get sequence
Deep sequencing48 reads, 16 experiments
Predicted targets

References

1
PMID:18583537 "MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries" Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M Stem Cells. 26:2496-2505(2008).