Mature sequence ptr-let-7i

Accession numberMIMAT0007943
IDptr-let-7i
Stem-Loop ptr-let-7i
Sequence
ugagguaguaguuugugcuguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).