Mature sequence ptr-miR-516b

Accession numberMIMAT0008183
IDptr-miR-516b
Stem-Loop ptr-mir-516b-1 ptr-mir-516b-2
Sequence
aucuggagguaagaagcacuuu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).