Mature sequence ptr-miR-522

Accession numberMIMAT0008206
IDptr-miR-522
Stem-Loop ptr-mir-522
Sequence
aaaaugguucccuuuagagugu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).