Mature sequence bta-miR-106b

Accession numberMIMAT0009218
IDbta-miR-106b
Stem-Loop bta-mir-106b
Sequence
uaaagugcugacagugcagau
Get sequence
Deep sequencing15394 reads, 73 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
2
PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).