Mature sequence bta-miR-135b

Accession numberMIMAT0009229
IDbta-miR-135b
Stem-Loop bta-mir-135b
Sequence
uauggcuuuucauuccuauguga
Get sequence
Deep sequencing166 reads, 53 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).