Mature sequence bta-miR-212

Accession numberMIMAT0009264
IDbta-miR-212
Stem-Loop bta-mir-212
Sequence
accuuggcucuagacugcuuacu
Get sequence
Deep sequencing286 reads, 56 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).