Mature sequence bta-miR-431

Accession numberMIMAT0009316
IDbta-miR-431
Stem-Loop bta-mir-431
Sequence
ugucuugcaggccgucaugcagg
Get sequence
Deep sequencing158 reads, 50 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).