Mature sequence bta-miR-486

• Accession number: MIMAT0009329
• ID: bta-miR-486
• Stem-Loop: bta-mir-486
• Sequence: uccuguacugagcugccccgag
• Deep sequencing: 90151 reads, 69 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-486

References

1. PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2. PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).
3. PMID:19758457 "Characterization of bovine miRNAs by sequencing and bioinformatics analysis" Jin W, Grant JR, Stothard P, Moore SS, Guan LL BMC Mol Biol. 10:90(2009).