Mature sequence bta-miR-665

Accession numberMIMAT0009363
IDbta-miR-665
Stem-Loop bta-mir-665
Sequence
accaguaggccgaggccccu
Get sequence
Deep sequencing3530 reads, 63 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).