Mature sequence bta-miR-744

Accession numberMIMAT0009369
IDbta-miR-744
Stem-Loop bta-mir-744
Sequence
ugcggggcuagggcuaacagca
Get sequence
Deep sequencing4495 reads, 67 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).