Mature sequence mmu-miR-1927

Accession numberMIMAT0009390
IDmmu-miR-1927
Stem-Loop mmu-mir-1927
Sequence
gaccucuggauguuagggacuga
Get sequence
Deep sequencing223 reads, 57 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).