Mature sequence mmu-miR-1936

Accession numberMIMAT0009400
IDmmu-miR-1936
Stem-Loop mmu-mir-1936
Sequence
uaacugaccugcugugaacuggc
Get sequence
Deep sequencing110 reads, 34 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).