Mature sequence mmu-miR-1962

Accession numberMIMAT0009435
IDmmu-miR-1962
Stem-Loop mmu-mir-1962
Sequence
agaggcuggcacugggacacau
Get sequence
Deep sequencing66 reads, 17 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).