Mature sequence bfl-let-7a-5p

Accession numberMIMAT0009462
IDbfl-let-7a-5p
Previous IDsbfl-let-7;bfl-let-7a
Stem-Loop bfl-let-7a-2 bfl-let-7a-1
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).
3
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).