Mature sequence aqu-miR-2018-5p

Accession numberMIMAT0009694
IDaqu-miR-2018-5p
Previous IDsaqu-miR-2018
Stem-Loop aqu-mir-2018
Sequence
ugucggagccggagguuccgga
Get sequence
Deep sequencing2219 reads, 9 experiments

References

1
PMID:18830242 "Early origins and evolution of microRNAs and Piwi-interacting RNAs in animals" Grimson A, Srivastava M, Fahey B, Woodcroft BJ, Chiang HR, King N, Degnan BM, Rokhsar DS, Bartel DP Nature. 455:1193-1197(2008).
2
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).