Mature sequence bta-miR-29e

Accession numberMIMAT0009953
IDbta-miR-29e
Stem-Loop bta-mir-29e
Sequence
uagcaucauuugaaaucaguguuu
Get sequence
Deep sequencing5093 reads, 74 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).