Mature sequence bta-miR-1296

Accession numberMIMAT0009964
IDbta-miR-1296
Stem-Loop bta-mir-1296
Sequence
uuagggcccuggcuccaucucc
Get sequence
Deep sequencing1072 reads, 64 experiments
Predicted targets

References

1
PMID:18945293 "Annotation of 390 bovine miRNA genes by sequence similarity with other species" Strozzi F, Mazza R, Malinverni R, Williams JL Anim Genet. 40:125(2009).