Mature sequence mtr-miR399g

Accession numberMIMAT0011074
IDmtr-miR399g
Stem-Loop mtr-MIR399g
Sequence
ugccaaaggagauuugcccag
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).