Mature sequence mtr-miR399l

Accession numberMIMAT0011092
IDmtr-miR399l
Stem-Loop mtr-MIR399l
Sequence
ugccaaaggagaguugcccug
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).