Mature sequence mtr-miR398c

Accession numberMIMAT0011097
IDmtr-miR398c
Stem-Loop mtr-MIR398c
Sequence
uguguucucaggucgccccug
Get sequence
Deep sequencing reads, experiments

References

1
" Bonnet E Unpublished (2007).