Mature sequence mmu-miR-2137

• Accession number: MIMAT0011213
• ID: mmu-miR-2137
• Stem-Loop: mmu-mir-2137
• Sequence: gccggcgggagccccagggag
• Deep sequencing: 8347 reads, 100 experiments
• Predicted targets:
  • TargetScanVert:mmu-miR-2137
  • miRDB:mmu-miR-2137
  • microrna.org:mmu-miR-2137

References

1. PMID:19351399 "Identification and characterization of new miRNAs cloned from normal mouse mammary gland" Sdassi N, Silveri L, Laubier J, Tilly G, Costa J, Layani S, Vilotte JL, Le Provost F BMC Genomics. 10:149(2009).