Mature sequence mmu-miR-2137

Accession numberMIMAT0011213
IDmmu-miR-2137
Stem-Loop mmu-mir-2137
Sequence
gccggcgggagccccagggag
Get sequence
Deep sequencing8347 reads, 100 experiments
Predicted targets

References

1
PMID:19351399 "Identification and characterization of new miRNAs cloned from normal mouse mammary gland" Sdassi N, Silveri L, Laubier J, Tilly G, Costa J, Layani S, Vilotte JL, Le Provost F BMC Genomics. 10:149(2009).