Mature sequence sme-miR-36c-3p

Accession numberMIMAT0011261
IDsme-miR-36c-3p
Previous IDssme-miR-36c
Stem-Loop sme-mir-36c
Sequence
ucaccggguagacauucauu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).