Mature sequence sme-miR-2156b-3p

Accession numberMIMAT0011394
IDsme-miR-2156b-3p
Previous IDssme-miR-2156b
Stem-Loop sme-mir-2156b
Sequence
ccuuacggccccuaaaccuuauu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).