Mature sequence crm-miR-246-5p

Accession numberMIMAT0011571
IDcrm-miR-246-5p
Previous IDscrm-miR-246
Stem-Loop crm-mir-246-1 crm-mir-246-2
Sequence
accuggccgauuucauguaauau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).