Mature sequence ppc-miR-2240b

Accession numberMIMAT0011689
IDppc-miR-2240b
Stem-Loop ppc-mir-2240b
Sequence
ucccagggauucucaguagauu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19755563 "Repertoire and evolution of miRNA genes in four divergent nematode species" de Wit E, Linsen SE, Cuppen E, Berezikov E Genome Res. 19:2064-2074(2009).