Mature sequence osa-miR2118d

Accession numberMIMAT0011743
IDosa-miR2118d
Stem-Loop osa-MIR2118d
Sequence
uuccugaugccucccaugccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).