Mature sequence osa-miR2118f

Accession numberMIMAT0011745
IDosa-miR2118f
Stem-Loop osa-MIR2118f
Sequence
uuccugaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).