Mature sequence osa-miR2118g

Accession numberMIMAT0011746
IDosa-miR2118g
Stem-Loop osa-MIR2118g
Sequence
uuccuaaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).