Mature sequence osa-miR2118n

Accession numberMIMAT0011753
IDosa-miR2118n
Stem-Loop osa-MIR2118n
Sequence
uucccgaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).