Mature sequence osa-miR2118o

Accession numberMIMAT0011754
IDosa-miR2118o
Stem-Loop osa-MIR2118o
Sequence
cuccugaugccucccaagccua
Get sequence
Deep sequencing5 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).