Mature sequence dme-miR-2279-3p

Accession numberMIMAT0011785
IDdme-miR-2279-3p
Previous IDsdme-miR-2279
Stem-Loop dme-mir-2279
Sequence
uuucacgcgaagauauuuauuu
Get sequence
Deep sequencing49 reads, 13 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:19541914 "Abundant primary piRNAs, endo-siRNAs, and microRNAs in a Drosophila ovary cell line" Lau NC, Robine N, Martin R, Chung WJ, Niki Y, Berezikov E, Lai EC Genome Res. 19:1776-1785(2009).
2
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).