Mature sequence bta-miR-2288

Accession numberMIMAT0011795
IDbta-miR-2288
Stem-Loop bta-mir-2288
Sequence
agguaguaggugugugguuu
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).