Mature sequence bta-miR-2284t-5p

• Accession number: MIMAT0011831
• ID: bta-miR-2284t-5p
• Previous IDs: bta-miR-2284t*
• Stem-Loop: bta-mir-2284t
• Sequence: gaaacauucacucggguuuuu
• Deep sequencing: 25 reads, 11 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-2284t-5p

References

1. PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2. PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).