Mature sequence bta-miR-2285b

Accession numberMIMAT0011833
IDbta-miR-2285b
Stem-Loop bta-mir-2285b-1 bta-mir-2285b-2
Sequence
aaaaucugagugaacuuuuugg
Get sequence
Deep sequencing1368 reads, 66 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).