Mature sequence bta-miR-2389

Accession numberMIMAT0011942
IDbta-miR-2389
Stem-Loop bta-mir-2389
Sequence
gaggggacucgggagucggag
Get sequence
Deep sequencing95 reads, 19 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).