Mature sequence bta-miR-2404

Accession numberMIMAT0011961
IDbta-miR-2404
Stem-Loop bta-mir-2404-1 bta-mir-2404-2
Sequence
uugcacugcaugguaucugc
Get sequence
Deep sequencing252 reads, 20 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).