Mature sequence bta-miR-2411-5p

Accession numberMIMAT0011972
IDbta-miR-2411-5p
Previous IDsbta-miR-2411
Stem-Loop bta-mir-2411
Sequence
uggagugacugucagaugcagcca
Get sequence
Deep sequencing159 reads, 54 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).
2
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).