Mature sequence bta-miR-320b

Accession numberMIMAT0011991
IDbta-miR-320b
Stem-Loop bta-mir-320b
Sequence
agcuggguugagaggguggu
Get sequence
Deep sequencing9323 reads, 69 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).