Mature sequence bta-miR-2424

Accession numberMIMAT0011993
IDbta-miR-2424
Stem-Loop bta-mir-2424-2 bta-mir-2424
Sequence
cagaucuuugguaaucugauggc
Get sequence
Deep sequencing466 reads, 61 experiments

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).