Mature sequence bta-miR-664a

Accession numberMIMAT0012078
IDbta-miR-664a
Previous IDsbta-miR-664
Stem-Loop bta-mir-664a
Sequence
caggcugggguguguguggaug
Get sequence
Deep sequencing16 reads, 5 experiments
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).