Mature sequence xtr-miR-2184

Accession numberMIMAT0012192
IDxtr-miR-2184
Sequence
aacaguaagagauuaugugcug
Get sequence
Stem-Loop xtr-mir-2184

References

1
PMID:19628731 "Abundant and dynamically expressed miRNAs, piRNAs, and other small RNAs in the vertebrate Xenopus tropicalis" Armisen J, Gilchrist MJ, Wilczynska A, Standart N, Miska EA Genome Res. 19:1766-1775(2009).