Mature sequence dme-miR-2498-3p

Accession numberMIMAT0012211
IDdme-miR-2498-3p
Previous IDsdme-miR-2498
Stem-Loop dme-mir-2498
Sequence
aaacuggcauucccgucuuacuu
Get sequence
Deep sequencing101 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).