Mature sequence bta-miR-365-5p

Accession numberMIMAT0012539
IDbta-miR-365-5p
Stem-Loop bta-mir-365-1
Sequence
agggacuuuugggggcagaugug
Get sequence
Deep sequencing1375 reads, 33 experiments
Predicted targets

References

1
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).