Mature sequence bmo-miR-306a-5p

Accession numberMIMAT0012629
IDbmo-miR-306a-5p
Previous IDsbmo-miR-306;bmo-miR-306a
Stem-Loop bmo-mir-306a
Sequence
ucagguacuaggugacucuga
Get sequence
Deep sequencing287002 reads, 3 experiments
Database links
QuickGO function

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
3
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).